autochthonous biology


NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. A preliminary phylogenetic analysis of our 291 partial sequences was done by distance methods (neighbor-joining, NJ) by using the program MUST (11), thus allowing the identification of identical or nearly identical sequences and the selection of clones for complete sequencing. Two of them consisted of an inert plastic mesh containing, respectively, a meat-based substrate and iron fragments, and a third one was made of basalt and pumice fragments. Compared with data from the Pacific Guaymas basin, some protist lineages seem ubiquitous in hydrothermal areas, whereas others, notably kinetoplastid lineages, very abundant and diverse in our samples, so far have been detected only in Atlantic systems. rDNA libraries were constructed, by using the TOPO TA Cloning system (Invitrogen), from PCR products coming from different samples and primer combinations. This is the case of AT4–68 and AT4–11 (Fig. * 1983 , Journal of the Medical Society of New Jersey , volume 80, page 538: When, in 1858, Joseph Lister amputated the right leg of a six-year-old girl suffering from gangrene, he noted that the autochthonous blood clot extended down the anterior tibial artery as far as the commencement of the gangrene. Given the large variety of divergent lineages detected within the alveolates in deep-sea plankton, hydrothermal sediments, and vents, alveolates seem to dominate the deep ocean in terms of diversity. These results should constitute a first base for comparison with data from the Pacific systems. The multiple alignment was then manually edited by using the program ED from the MUST package (11). Eukaryotes thriving in Rainbow sediment are likely anaerobic and clearly metallo-tolerant because, as shown by chemical analysis, this site holds records of high concentrations in several metals and rare-earth elements. Sequences representing unknown alveolate groups are highlighted. In any case, our results suggest that alvinellids constitute a family larger than that presently recognized and whose ancestors adapted to Pacific and Atlantic deep-sea vents, probably before the separation of the two oceanic provinces. 2) and recovered after 15 days (see Methods). We carried out a molecular survey based on 18S ribosomal RNA genes of eukaryotes present in different hydrothermal niches at the Mid-Atlantic Ridge. Posted by admin. These were at least occasionally exposed to very high temperatures, which is attested to by the fact that part of the 190°C-resistant microcolonizer tubes was partially burnt. (2003), Proceedings of the National Academy of Sciences, Earth, Atmospheric, and Planetary Sciences, Likelihood of life and intelligence emerging, Copyright © 2003, The National Academy of Sciences. To discriminate which lineages are endemic to hydrothermal systems, a comprehensive protist survey of nonhydrothermal deep-sea sediment and plankton will be required. The acidic (pH ≈2.8) and hot (≈365°C) Rainbow vent fluids are unique, being enriched in H2, methane, Mn, Fe, Co, Ni, Cu, Zn, Ag, Cd, Cs, Pb, Y, and rare-earth elements (13), thus influencing sediment composition. Isotopic analysis can help to distinguish these carbons.
To date, whereas prokaryotes seem ubiquitous in different oceanic regions (7), possibly including vent areas, metazoans are subject to a defined biogeographical distribution (8). Known alvinellid species build tubes, which are not apparent in Atlantic chimneys.
The scale bar indicates the percentage of substitutions for a unit branch length. After nucleic acid extraction, amplification, and cloning of 18S rRNA genes from the different samples, we partially sequenced ≈300 insert clones. Samples were dehydrated in increasing ethanol concentrations (50%, 70%, 90%, and 100%), critical-point-dried, and gold-coated. We also detected a relatively basal kinetoplastid sequence related to the genus Ichthyobodo (Fig. ↵‡ Present address: Unité d'Ecologie, Systématique et Evolution, Unité Mixte de Recherche Centre National de la Recherche Scientifique 8079, Université Paris-Sud, Bâtiment 360, 91405 Orsay Cedex, France. 3–5), which correlates well with the diversity found in microcolonizers. autochthonous | Definitions for autochthonous from GenScript molecular biology glossary. These seem more or less distantly related to sequences LEMD and BOLA coming from anoxic environments (6). We thank Magali Zbinden for efficient sample processing on board during the ATOS cruise, the ATOS chief scientist, Pierre Marie Sarradin, and the crew of the oceanographic ship Atalante. Nevertheless, we cannot exclude the possibility of errant alvinellid-related polychaetes thriving in the Atlantic hydrothermal systems. First, we aimed at characterizing the diversity of autochthonous microbial eukaryotes from Mid-Atlantic Ridge hydrothermal systems. This finding leaves open the possibility that some of the eukaryotic lineages detected were thermophilic. The molecular analyses of the three different microcolonizer substrates (organic, iron-rich, and mineral) showed no significant differences of eukaryotic diversity among them. The container was opened in a laminar flux chamber on board, and the microcolonizers were stored at 4°C in 75% ethanol/2% NaCl. 18S rRNA genes presented in this work were amplified with PCR by using different combinations of the primers 18S-42F (CTCAARGAYTAAGCCATGCA), 18S-82F (GAAACTGCGAATGGCTC), 18S-1498R (CACCTACGGAAACCTTGTTA), and 18S-1520R (CYGCAGGTTCACCTAC). This result indicates that their DNA is degraded before deposition at the 2,264-m deep Rainbow site. Edited by Rita R. Colwell, National Science Foundation, Arlington, VA, and approved November 27, 2002 (received for review September 24, 2002). 5). Thank you for your interest in spreading the word on PNAS. This result would tend to support a view of a microaerophilic nature for these eukaryotes. The Rainbow sediment we studied was particularly interesting because of its very high metal content. Recent eukaryotic diversity surveys based on 18S rRNA are revealing an unexpected variety of often divergent lineages in different biotopes, including some extreme environments (1–6). 1). Biogenic CaCO3 accounted for ≈32% of total sediment weight (Tables 1 and 2) and seems to be contributed mostly by very abundant haptophyte coccoliths and foraminifer shells, as revealed by direct observation with scanning electron microscopy (Fig. In combination with previous data from deep-sea plankton (1), the amazing variety of alveolates in both sediment and microcolonizers suggests that alveolates dominate, in terms of genetic diversity, the deep ocean. From these, 37 representative clones were selected for complete sequencing, and the sequences aligned with 4,575 additional 18S rRNA gene sequences for phylogenetic reconstruction (see Methods). This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. ↵¶ Present address: Département de Biochimie, Université de Montréal, C.P.

Unrooted ML phylogenetic tree of major eukaryotic groups based on 18S rDNA sequences.

At present, molecular data on the oceanic distribution of microbial eukaryotes are still negligible. In streams periphyton produce autochthonous carbon, while leaves and needles which fall into the stream is allochthonous carbon. Fluid–seawater mixtures were collected from vents by using 0.75-liter titanium bottles at Lucky Strike (37°17′N, 32°16′W, depth 1,695 m) and Rainbow chimneys; they were then filtered sequentially through 5- and 0.2-μm-diameter Millipore filters. After plating, 25–100 positive transformants per library were screened by PCR amplification of inserts using flanking vector primers. 3–5). Some mussels' mortalities attributed to bacterial infections might indeed be the product of protist parasitism. 2) and collected in a closed sterile container by the ROV Victor. By using an MP tree, the parameter values for a general time-reversible model of nucleotide substitution were estimated, with a six-category discrete approximation of a Γ distribution plus invariable sites (GTR + Γ + I model). Cellular lysis in sediment and microcolonizer substrates was accomplished after several freeze–thaw cycles in liquid nitrogen by overnight incubation at 55°C in a proteinase K/SDS solution.